Regular Expressions 101

Save & Share

  • Regex Version: ver. 2
  • Update Regex
    ctrl+⇧+s
  • Save new Regex
    ctrl+s
  • Add to Community Library

Flavor

  • PCRE2 (PHP >=7.3)
  • PCRE (PHP <7.3)
  • ECMAScript (JavaScript)
  • Python
  • Golang
  • Java 8
  • .NET 7.0 (C#)
  • Rust
  • Regex Flavor Guide

Function

  • Match
  • Substitution
  • List
  • Unit Tests

Tools

Sponsors
There are currently no sponsors. Become a sponsor today!
An explanation of your regex will be automatically generated as you type.
Detailed match information will be displayed here automatically.
  • All Tokens
  • Common Tokens
  • General Tokens
  • Anchors
  • Meta Sequences
  • Quantifiers
  • Group Constructs
  • Character Classes
  • Flags/Modifiers
  • Substitution
  • A single character of: a, b or c
    [abc]
  • A character except: a, b or c
    [^abc]
  • A character in the range: a-z
    [a-z]
  • A character not in the range: a-z
    [^a-z]
  • A character in the range: a-z or A-Z
    [a-zA-Z]
  • Any single character
    .
  • Alternate - match either a or b
    a|b
  • Any whitespace character
    \s
  • Any non-whitespace character
    \S
  • Any digit
    \d
  • Any non-digit
    \D
  • Any word character
    \w
  • Any non-word character
    \W
  • Non-capturing group
    (?:...)
  • Capturing group
    (...)
  • Zero or one of a
    a?
  • Zero or more of a
    a*
  • One or more of a
    a+
  • Exactly 3 of a
    a{3}
  • 3 or more of a
    a{3,}
  • Between 3 and 6 of a
    a{3,6}
  • Start of string
    ^
  • End of string
    $
  • A word boundary
    \b
  • Non-word boundary
    \B

Regular Expression
No Match

/
/

Test String

Code Generator

Language

Generated Code

import Foundation let pattern = #"a"# let regex = try! NSRegularExpression(pattern: pattern) let testString = ##""" STAT 545 REGULAR EXPRESSION TEST BED ------------------------------------ abcdefghijklmnopqrstuvwxyz ABCDEFGHIJKLMNOPQRSTUVWXYZ 0123456789 +-.,!@#$%^&*();\/|<>"' 12345 -98.7 3.141 .6180 9,000 +42 Twas brillig, and the slithy toves Did gyre and gimble in the wabe; All mimsy were the borogoves, And the mome raths outgrabe. 3317 Route 202 Long Branch, NJ 07740 9303 Route 1 Sun City, AZ 85351 CHALLENGES ------------------------------------- RULES 1. Match ONLY the target elements (check top of document as well!) 2. Must be a separate match for each discrete element 3. THERE ARE CANDY PRIZES 1. DNA: TCCGTATCAAGATCCTCTTAATAAGCCCCCGTCACTGTTGGTTGTAGAGCCCAGGACGGGTTGGCCAGATGTGCGACTATATCGCTTAGTGGCTCTTGGGCC GATAGCTTCTTACCGGTGCGCCTCCGTACGCAGTACGATCGCACGCCCCATGAGAACGATAGGTAAACCTGGTGTCCTGTGAGCGACAAAAGCTTAAATGG 2. SMILIES: :D :) :o :P :/ 3. EMAIL ADDRESSES: foo@demo.net bar.ba@test.co.uk 4. HTML Tags: <p>The <a class="APILink" target="_blank" href="https://docs.oracle.com/javase/8/docs/api/java/util/regex/Pattern.html"><code>Pattern</code></a> API contains a number of useful <i>predefined character classes</i>, which offer convenient shorthands for commonly used regular expressions:</p> <p><a name="CHART" id="CHART"></a></p> 5. PHONE NUMBERS: 555.123.4567 +1-800-555-2468 +49 7743 9901 6. URLs: www.demo.com http://foo.co.uk/ 7. MACHO MAN RANDY SAVAGE QUOTATIONS: “History beckons the Nacho Man.” “Hulkamania is like a single grain of sand in the Sahara desert that is Nacho Madness.” "Snap into a Slim Jim!" 9. CITATIONS: We based our calculations on previously published methods (Nadeu 2006). We also used a support vector machine, which is a classification method that is able to deal with highly variable data (Camps-Valls et al. 2004). The population of this species...where the presence and transmission of introduced avian malaria (Plasmodium relictum) is low (Eggert et al. 2008, Dziel et al. 2010) """## let stringRange = NSRange(location: 0, length: testString.utf16.count) if let firstMatch = regex.firstMatch(in: testString, range: stringRange) { let result: [String] = (1 ..< firstMatch.numberOfRanges).map { (testString as NSString).substring(with: firstMatch.range(at: $0)) } print(result) } else { print("No matches were found.") }

Please keep in mind that these code samples are automatically generated and are not guaranteed to work. If you find any syntax errors, feel free to submit a bug report. For a full regex reference for Swift 5.2, please visit: https://developer.apple.com/documentation/foundation/nsregularexpression